miScript II RT Kit
For reverse transcription of total RNA containing miRNA using the miScript PCR System
Features
- cDNA for sensitive and specific miRNA detection
- A single cDNA enables quantification of multiple miRNAs
- Quantification of miRNA and mRNA from the same cDNA
- Proprietary synthetic RNA to assess reverse transcription efficiency
Product Details
The miScript II RT Kit is an integral component of the miScript PCR System for miRNA detection and quantification. cDNA generated with the miScript II RT Kit is used as a template for real-time PCR with the miScript SYBR Green PCR Kit and either PCR arrays (miRNome or Pathway-Focused miScript miRNA PCR Arrays) or appropriate assays (miScript Primer Assays for miRNA or other noncoding RNA or QuantiTect Primer Assays for mRNA).
Important note: This product line will be discontinued on May 1, 2021 and will be replaced by the miRCURY LNA miRNA PCR system. We strongly recommend using miRCURY LNA RT Kit for better miRNA quantification and profiling.
For more information about this transition, please visit our dedicated knowledge hub or contact us.
Performance
The miScript II RT Kit, together with the components of the miScript PCR System, ensures sensitive, specific miRNA detection and quantification. As many miRNAs are expressed at low levels, sensitivity is critical to ensure reliable data. The miScript PCR System provides exceptional sensitivity, a broad dynamic range, and consistently high amplification efficiencies. The high performance of the miScript PCR System ensures highly reproducible results between technical and biological replicates at the first attempt (see figure Reproducible results in technical and biological replicates).
High specificity
Many miRNA isoforms families exist in which miRNAs differ by only a single base. This presents a significant challenge in miRNA quantification. The miScript PCR System can efficiently discriminate between closely related miRNA isoforms, even when they differ by only a single base (see tables).
| miRNA sequence | |
| Let-7b | UGAGGUAGUAGGUUGUGUGGUU |
| Let-7c | UGAGGUAGUAGGUUGUAUGGUU |
| miR-98 | UGAGGUAGUAAGUUGUAUUGUU |
| Let-7d | AGAGGUAGUAGGUUGCAUAGUU |
| Let-7e | UGAGGUAGGAGGUUGUAUAGUU |
| Let-7a | UGAGGUAGUAGGUUGUAUAGUU |
| Let-7f | UGAGGUAGUAGAUUGUAUAGUU |
| Let-7g | UGAGGUAGUAGUUUGUACAGUU |
| Let-7i | UGAGGUAGUAGUUUGUGCUGUU |
| cDNA used in PCR | Let-7b | Let-7c | miR-98 | Let-7d | Let-7e | Let-7a | Let-7f | Let-7g | Let-7i |
| Let-7b | 100.00 | 1.78 | 0.00 | 0.00 | 0.00 | 0.01 | 0.00 | 0.00 | 0.01 |
| Let-7c | 0.54 | 100.00 | 0.00 | 0.00 | 1.01 | 0.12 | 0.00 | 0.00 | 0.00 |
| miR-98 | 0.00 | 0.21 | 100.00 | 0.06 | 0.01 | 0.05 | 0.00 | 0.01 | 0.13 |
| Let-7d | 0.05 | 0.02 | 0.00 | 100.00 | 0.00 | 0.38 | 0.00 | 0.00 | 0.01 |
| Let-7e | 0.05 | 0.01 | 0.00 | 0.02 | 100.00 | 0.23 | 0.00 | 0.00 | 0.01 |
| Let-7a | 0.07 | 0.64 | 0.00 | 0.54 | 3.86 | 100.00 | 0.06 | 0.04 | 0.02 |
| Let-7f | 0.55 | 0.12 | 0.01 | 0.11 | 0.03 | 1.05 | 100.00 | 0.14 | 0.13 |
| Let-7g | 0.58 | 0.17 | 0.01 | 0.08 | 0.00 | 0.04 | 0.01 | 100.00 | 0.17 |
| Let-7i | 0.13 | 0.02 | 0.01 | 0.02 | 0.00 | 0.01 | 0.00 | 0.10 | 100.00 |
See figures
Principle
The miScript PCR System enables sensitive, specific miRNA quantification and profiling using SYBR Green-based real-time PCR. The miScript PCR System covers all the steps involved in conversion of RNA to cDNA and subsequent real-time PCR detection of miRNAs.
The miScript PCR System comprises:
- miScript II RT Kit — this kit enables simple, single-step cDNA synthesis. A single cDNA synthesis reaction can be used for detection of hundreds of miRNAs. The dual buffer system meets the distinctive needs of miRNA quantification using real-time PCR.
- miScript SYBR Green PCR Kit — this kit includes QuantiTect SYBR Green PCR Master Mix and the miScript Universal Primer, a reverse primer that allows detection of miRNAs in combination with a miScript Primer Assay or miScript miRNA PCR Array.
- miScript Primer Assay — miScript Primer Assays are miRNA-specific forward primers designed to detect mature miRNAs.
- miScript miRNA PCR Array — miRNome or Pathway-Focused miScript miRNA PCR Arrays are preformatted, single-use PCR arrays for rapid profiling of mature miRNAs.
- miScript miRNA PCR Array data analysis tool — this complimentary, Web-based tool simplifies the ΔΔCT method of relative quantification for miScript miRNA PCR Arrays.
miScript II RT Kit dual buffer system
The miScript II RT Kit includes miScript Reverse Transcriptase Mix, 10x miScript Nucleics Mix, 5x miScript HiSpec Buffer, and 5x miScript HiFlex Buffer. miScript Reverse Transcriptase Mix is an optimized blend of poly(A) polymerase and reverse transcriptase. miScript Nucleics Mix contains dNTPs, rATP, oligo-dT primers, and an internal synthetic RNA control (miRNA reverse transcription control [miRTC]) that is used to assess reverse transcription performance during profiling experiments with miScript miRNA PCR Arrays (for more information, see the miScript miRNA PCR Array Handbook).
Two buffers, miScript HiSpec Buffer and miScript HiFlex Buffer, are provided in the miScript II RT Kit to meet the distinctive needs of miRNA quantification studies using real-time PCR (see figure miScript II RT Kit buffers). miScript HiSpec Buffer is specifically formulated to provide optimal results in mature miRNA profiling and quantification experiments using miScript miRNA PCR Arrays and miScript Primer Assays. miScript HiFlex Buffer is highly suited to low-throughput miRNA quantification experiments, in addition to experiments where different RNA species, such as miRNA, mRNA, and precursor miRNA, are quantified from the same sample.
Reverse transcription in miScript HiSpec Buffer
Reverse transcription reactions performed using miScript HiSpec Buffer ensure the selective conversion of mature miRNAs and the targets of miScript PCR Controls into cDNA. Mature miRNAs are polyadenylated by poly(A) polymerase and reverse transcribed into cDNA using oligo-dT primers (see figure Selective conversion of mature miRNAs into cDNA in miScript HiSpec Buffer). Polyadenylation and reverse transcription are performed in parallel in the same tube. The oligo-dT primers have a 3' degenerate anchor and a universal tag sequence on the 5' end, allowing amplification of mature miRNA in the real-time PCR step. miScript Primer Assays, used in combination with the miScript SYBR Green PCR Kit, enable sensitive, specific quantification of mature miRNA by real-time PCR. The combination of polyadenylation and the universal tag addition ensures that miScript Primer Assays do not detect genomic DNA.
Reverse transcription in miScript HiFlex Buffer
Reverse transcription reactions performed using miScript HiFlex Buffer allow the conversion of all RNA species into cDNA (see figure Simultaneous conversion of all RNA species into cDNA in miScript HiFlex Buffer). Mature miRNAs are polyadenylated by poly(A) polymerase and reverse transcribed into cDNA using oligo-dT primers. Polyadenylation and reverse transcription are performed in parallel in the same tube. The oligo-dT primers have a 3' degenerate anchor and a universal tag sequence on the 5' end allowing amplification of mature miRNA in the real-time PCR step. miScript Primer Assays, used in combination with the miScript SYBR Green PCR Kit, enable quantification of mature miRNA by real-time PCR. The combination of polyadenylation and the universal tag addition ensures that miScript Primer Assays do not detect genomic DNA. All other RNA species (including precursor miRNA, other noncoding RNA, and mRNA) are also converted into cDNA using oligo-dT and random primers. Real-time PCR detection of these RNAs can then be performed using the appropriate assays (e.g., miScript Primer Assays for noncoding RNA detection and QuantiTect Primer Assays for mRNA detection) in combination with the miScript SYBR Green PCR Kit (see figure Simultaneous conversion of all RNA species into cDNA in miScript HiFlex Buffer).
See figures
Procedure
Reverse transcription reactions are easy to perform. Total RNA containing miRNA is used as starting material for reverse transcription reactions. Reverse transcription is a straightforward procedure which includes incubation of the reaction at 37oC for 1 hour, followed by inactivation of the reaction by briefly incubating at 95oC.
Applications
The miScript II RT Kit is used as part of the miScript PCR System for:
- Mature miRNA quantification and profiling
- miRNA and mRNA detection in parallel
- snoRNA and other noncoding RNA detection
Supporting data and figures
miScript II RT Kit buffers.
Two buffers are supplied with the miScript II RT Kit. Use miScript HiSpec Buffer for cDNA synthesis to enable either mature miRNA profiling (using miScript miRNA PCR Arrays) or mature miRNA quantification using individual miScript Primer Assays. Use miScript HiFlex Buffer for cDNA synthesis to enable quantification of mature miRNA, precursor miRNA, noncoding RNA (ncRNA), and/or mRNA from the same cDNA. cDNA prepared using either miScript HiSpec Buffer or miScript HiFlex Buffer can be used with miScript PCR Controls.
Resources
Safety Data Sheets (1)
FAQ
What is the sequence of the miScript Universal Primer?
Are any of the miScript II RT Kit components interchangeable with the miScript Plant RT Kit components?
Is the expression level of miRNA precursors lower compared to that of mature miRNAs?
What is in the HiSpec Buffer that selectively synthesizes cDNA from mature miRNAs ONLY?
Can the miScript II RT Kit be used to quantify plant miRNAs?
Can I use total RNA for the miRNA PCR Arrays or Assays?
Can the miScript II RT Kit be used to quantify piRNAs?